#!/usr/bin/perl -w
# From: "Beginning Perl for Bioinformatics", James Tisdall, O'Reilly, 2001
# Example 4-3   Transcribing DNA into RNA

# The DNA
$DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';

# Print the DNA onto the screen
print "Here is the starting DNA:\n\n";

print "$DNA\n\n";

# Transcribe the DNA to RNA by substituting all T's with U's.
$RNA = $DNA;

$RNA =~ s/T/U/g;

# Print the RNA onto the screen
print "Here is the result of transcribing the DNA to RNA:\n\n";

print "$RNA\n";

# Exit the program.
exit;